Review





Similar Products

92
MedChemExpress recombinant murine cxcl13
Recombinant Murine Cxcl13, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant murine cxcl13/product/MedChemExpress
Average 92 stars, based on 1 article reviews
recombinant murine cxcl13 - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier

93
R&D Systems c36950 mouse cxcl13 blc bca 1 quantikine elisa r d systems
C36950 Mouse Cxcl13 Blc Bca 1 Quantikine Elisa R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c36950 mouse cxcl13 blc bca 1 quantikine elisa r d systems/product/R&D Systems
Average 93 stars, based on 1 article reviews
c36950 mouse cxcl13 blc bca 1 quantikine elisa r d systems - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
PeproTech recombinant mouse cxcl13
FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, <t>CXCL12</t> or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .
Recombinant Mouse Cxcl13, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse cxcl13/product/PeproTech
Average 90 stars, based on 1 article reviews
recombinant mouse cxcl13 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
MedChemExpress hy p77912
FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, <t>CXCL12</t> or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .
Hy P77912, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hy p77912/product/MedChemExpress
Average 90 stars, based on 1 article reviews
hy p77912 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

99
OriGene mouse cxcl13 forward 50 catagatcggattcaagttacgcc
FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, <t>CXCL12</t> or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .
Mouse Cxcl13 Forward 50 Catagatcggattcaagttacgcc, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse cxcl13 forward 50 catagatcggattcaagttacgcc/product/OriGene
Average 99 stars, based on 1 article reviews
mouse cxcl13 forward 50 catagatcggattcaagttacgcc - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier

90
Thermo Fisher anti-mouse cxcl13 apc
FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, <t>CXCL12</t> or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .
Anti Mouse Cxcl13 Apc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-mouse cxcl13 apc/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
anti-mouse cxcl13 apc - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Thermo Fisher anti-mouse cxcl13-apc
FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, <t>CXCL12</t> or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .
Anti Mouse Cxcl13 Apc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-mouse cxcl13-apc/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
anti-mouse cxcl13-apc - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Thermo Fisher rat anti-mouse cxcl13–apc
FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, <t>CXCL12</t> or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .
Rat Anti Mouse Cxcl13–Apc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat anti-mouse cxcl13–apc/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
rat anti-mouse cxcl13–apc - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
R&D Systems cxcl13
A Schematic representation of the anti-PD1 (α-PD1), anti-TIGIT (α-TIGIT), and combined (α-PD1 + TIGIT) antibody treatments. Nf1 -OPG mice were treated (200 µg/dose/ i.p., twice per week) from 12 to 16 weeks of age, and tissues were analyzed at 16 weeks. The control group was injected with anti-IgG isotype control antibodies. Created in BioRender. Chatterjee, J. (2024) BioRender.com/r98n914. B Immunohistochemistry and quantification CD8 + T cells in the entire optic nerve (IgG, n = 10 mice; α-TIGIT, n = 10 mice; α-PD1, n = 6 mice; α-PD1 + TIGIT, n = 5 mice). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated (α-TIGIT, P = 0.0054; α-PD1, P = 0.0003; α-PD1 + TIGIT, P = 0.0032). Scale bar, 200 µm. C Ccl2 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 5, 2 pooled optic nerves per sample; α-TIGIT n = 5, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated. D Volcano plot showing fold change and P value comparing Nf1 -OPG TAM to Nf1 +/ and WT monocytes in the optic nerves of 12-week-old mice. Upregulated genes in red, downregulated genes in blue. Differential analyses were performed using gene specific analysis (GSA). E Ccr2, Cxcr3 , and Cxcr5 expression in T cell populations from 12-week-old Nf1 -OPG mouse optic nerves, color-coded by T cell type. F Cxcl9, Ccl12 , and <t>Cxcl13</t> RNA expression in the optic nerves of 12-week-old WT and Nf1 -OPG mice. Data are represented relative to the WT group ( Cxcl9 ; WT n = 3, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample; Ccl12 ; WT n = 4, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample; Cxcl13 ; WT n = 4, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. To evaluate statistical differences, a two-tailed non-parametric Mann–Whitney test was performed. Exact P values are indicated. ns, not significant. G Graph showing the percentage of migrated Nf1 +/- CD8 + T cells treated with medium (Control) ( n = 5), Ccl12 ( n = 6), or Cxcl13 ( n = 5). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated. Created in BioRender. Chatterjee, J. (2024) BioRender.com/r98n914. H Ccl12 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 5, 2 pooled optic nerves per sample; α-TIGIT n = 5, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 3, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Tukey’s post-test correction. Exact P values are indicated (α-TIGIT, P = 0.0012; α-PD1, P = 0.0187; α-PD1 + TIGIT, P = 0.0013). I Cxcl13 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 4, 2 pooled optic nerves per sample; α-TIGIT n = 4, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Tukey’s post test correction. Exact P values are indicated (α-TIGIT, P = 0.0003; α-PD1, P = 0.0007; α-PD1 + TIGIT, P = 0.0001).
Cxcl13, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cxcl13/product/R&D Systems
Average 93 stars, based on 1 article reviews
cxcl13 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, CXCL12 or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .

Journal: Frontiers in Immunology

Article Title: CXCR5 engineered human and murine Tregs for targeted suppression in secondary and tertiary lymphoid organs

doi: 10.3389/fimmu.2025.1513009

Figure Lengend Snippet: FVIII TRuCε CXCR5 Tregs display improved in vitro and in vivo persistence. (A) In vitro migration of FVIII CAR, FVIII CAR CXCR5, and FVIII TRuCε transduced Tregs through a transwell in response to either serum free media, CXCL12 or CXCL13 gradients. Number of migrated mScarlet + cells at the bottom of the transwell are quantified by flow cytometry following 6hrs of incubation. (B) Kinetics of in vivo migration of adoptively transferred FVIII TRuCε or FVIII TRuCε CXCR5 T conv cells to the spleen on days 1, 2, 4, and 7 following adoptive transfer. Mice received i.v. injections of recombinant FVIII on days 0, 3, and 6. Frequencies of mScarlet + cells per total CD4 + T cells are quantified by flow cytometry. (C) Number of mScarlet + FVIII TRuCε or FVIII TRuCε CXCR5 Tregs per 10 7 CD4 + T cells are quantified from spleens and (D) inguinal lymph nodes (ILN) on day 7 post adoptive transfer. Data represents mean±SEM, ****p<0.0001, ∗p < 0.05, ∗∗p < 0.01 using 2-way ANOVA with Tukey’s multiple comparisons analysis for (A) , 2-way ANOVA with Sidak’s multiple comparisons analysis for (B) , unpaired t test for (C, D) .

Article Snippet: Lower chambers contained 600 μL serum-free medium with 1μg/mL of either recombinant mouse CXCL12 or CXCL13 (PeproTech, Rocky Hill, NJ).

Techniques: In Vitro, In Vivo, Migration, Flow Cytometry, Incubation, Adoptive Transfer Assay, Recombinant

A Schematic representation of the anti-PD1 (α-PD1), anti-TIGIT (α-TIGIT), and combined (α-PD1 + TIGIT) antibody treatments. Nf1 -OPG mice were treated (200 µg/dose/ i.p., twice per week) from 12 to 16 weeks of age, and tissues were analyzed at 16 weeks. The control group was injected with anti-IgG isotype control antibodies. Created in BioRender. Chatterjee, J. (2024) BioRender.com/r98n914. B Immunohistochemistry and quantification CD8 + T cells in the entire optic nerve (IgG, n = 10 mice; α-TIGIT, n = 10 mice; α-PD1, n = 6 mice; α-PD1 + TIGIT, n = 5 mice). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated (α-TIGIT, P = 0.0054; α-PD1, P = 0.0003; α-PD1 + TIGIT, P = 0.0032). Scale bar, 200 µm. C Ccl2 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 5, 2 pooled optic nerves per sample; α-TIGIT n = 5, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated. D Volcano plot showing fold change and P value comparing Nf1 -OPG TAM to Nf1 +/ and WT monocytes in the optic nerves of 12-week-old mice. Upregulated genes in red, downregulated genes in blue. Differential analyses were performed using gene specific analysis (GSA). E Ccr2, Cxcr3 , and Cxcr5 expression in T cell populations from 12-week-old Nf1 -OPG mouse optic nerves, color-coded by T cell type. F Cxcl9, Ccl12 , and Cxcl13 RNA expression in the optic nerves of 12-week-old WT and Nf1 -OPG mice. Data are represented relative to the WT group ( Cxcl9 ; WT n = 3, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample; Ccl12 ; WT n = 4, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample; Cxcl13 ; WT n = 4, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. To evaluate statistical differences, a two-tailed non-parametric Mann–Whitney test was performed. Exact P values are indicated. ns, not significant. G Graph showing the percentage of migrated Nf1 +/- CD8 + T cells treated with medium (Control) ( n = 5), Ccl12 ( n = 6), or Cxcl13 ( n = 5). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated. Created in BioRender. Chatterjee, J. (2024) BioRender.com/r98n914. H Ccl12 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 5, 2 pooled optic nerves per sample; α-TIGIT n = 5, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 3, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Tukey’s post-test correction. Exact P values are indicated (α-TIGIT, P = 0.0012; α-PD1, P = 0.0187; α-PD1 + TIGIT, P = 0.0013). I Cxcl13 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 4, 2 pooled optic nerves per sample; α-TIGIT n = 4, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Tukey’s post test correction. Exact P values are indicated (α-TIGIT, P = 0.0003; α-PD1, P = 0.0007; α-PD1 + TIGIT, P = 0.0001).

Journal: Nature Communications

Article Title: Human single cell RNA-sequencing reveals a targetable CD8 + exhausted T cell population that maintains mouse low-grade glioma growth

doi: 10.1038/s41467-024-54569-4

Figure Lengend Snippet: A Schematic representation of the anti-PD1 (α-PD1), anti-TIGIT (α-TIGIT), and combined (α-PD1 + TIGIT) antibody treatments. Nf1 -OPG mice were treated (200 µg/dose/ i.p., twice per week) from 12 to 16 weeks of age, and tissues were analyzed at 16 weeks. The control group was injected with anti-IgG isotype control antibodies. Created in BioRender. Chatterjee, J. (2024) BioRender.com/r98n914. B Immunohistochemistry and quantification CD8 + T cells in the entire optic nerve (IgG, n = 10 mice; α-TIGIT, n = 10 mice; α-PD1, n = 6 mice; α-PD1 + TIGIT, n = 5 mice). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated (α-TIGIT, P = 0.0054; α-PD1, P = 0.0003; α-PD1 + TIGIT, P = 0.0032). Scale bar, 200 µm. C Ccl2 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 5, 2 pooled optic nerves per sample; α-TIGIT n = 5, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated. D Volcano plot showing fold change and P value comparing Nf1 -OPG TAM to Nf1 +/ and WT monocytes in the optic nerves of 12-week-old mice. Upregulated genes in red, downregulated genes in blue. Differential analyses were performed using gene specific analysis (GSA). E Ccr2, Cxcr3 , and Cxcr5 expression in T cell populations from 12-week-old Nf1 -OPG mouse optic nerves, color-coded by T cell type. F Cxcl9, Ccl12 , and Cxcl13 RNA expression in the optic nerves of 12-week-old WT and Nf1 -OPG mice. Data are represented relative to the WT group ( Cxcl9 ; WT n = 3, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample; Ccl12 ; WT n = 4, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample; Cxcl13 ; WT n = 4, 2 pooled optic nerves per sample; Nf1 -OPG n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. To evaluate statistical differences, a two-tailed non-parametric Mann–Whitney test was performed. Exact P values are indicated. ns, not significant. G Graph showing the percentage of migrated Nf1 +/- CD8 + T cells treated with medium (Control) ( n = 5), Ccl12 ( n = 6), or Cxcl13 ( n = 5). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Dunnett’s post-test correction. Exact P values are indicated. Created in BioRender. Chatterjee, J. (2024) BioRender.com/r98n914. H Ccl12 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 5, 2 pooled optic nerves per sample; α-TIGIT n = 5, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 3, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Tukey’s post-test correction. Exact P values are indicated (α-TIGIT, P = 0.0012; α-PD1, P = 0.0187; α-PD1 + TIGIT, P = 0.0013). I Cxcl13 RNA expression in the optic nerves of Nf1 -OPG mice treated with IgG, α-TIGIT, α-PD1 or a combination of α-PD1 and α-TIGIT antibodies. Data are represented relative to the IgG control group (IgG, n = 4, 2 pooled optic nerves per sample; α-TIGIT n = 4, 2 pooled optic nerves per sample; α-PD1, n = 4, 2 pooled optic nerves per sample; α-PD1 + TIGIT, n = 4, 2 pooled optic nerves per sample). Data are represented as mean ± SD. A one-way ANOVA test was performed followed by a Tukey’s post test correction. Exact P values are indicated (α-TIGIT, P = 0.0003; α-PD1, P = 0.0007; α-PD1 + TIGIT, P = 0.0001).

Article Snippet: 500 μl of chemoattractant media (Ccl12 [25 ng/ml, 428-P5-025- R&D systems ] and Cxcl13 [1 µg/ml, 470-BC-025- R&D systems] ) was added to the lower chamber, and the number of T cells in the lower chambers counted 6 h later.

Techniques: Control, Injection, Immunohistochemistry, RNA Expression, Expressing, Two Tailed Test, MANN-WHITNEY